fuckrubrik

Kom nyss hem,
det gick bra idag,
behöver bara öva på sångerna lite mer (:


promise me

Tänk, imorgon är julia i spanien :(

jag kommer sakna dig ♥



Nu går jag till Fia och Ola (:


Puss♥




Ibland vill man bara skrika "jag finns!"

MAMMA LÄSER EXTRA NOGA :D



Önskelista !


Pengar
Presentkort, ginatricot, JC, H&M, vila, veromoda, kicks, makeupstore, dinsko, skopunken m.m...
Parfym, britneyspears - fantasy, naomicampbell - at night, christinaaguilera
Nagellack 
Skor, svartapumps och stövlarna på bilden
Röd Ipod
Mobilt bredband
Solariumpresentkort
ID smink
vanligt smink



PUSS ♥

ecuador


Vi slutade typ tolv idag för vi hade ingen idrott,
idrottsläraren var sjuk.

Så nu ska jag plugga no och so....


ikväll är det luciaträning, det ska bli kuul :D


Imorgon = ingen skooola !


För först har vi en halvtimmes no då vi bara skulle göra massage
och sen har vi svenska och då gör vi bara typ tjejgrupper eller något.
Och siste har vi b språk och där gör jag inte ett skit.
Efter lunchen har vi friluftsdag och jag känner inte för att spela minigolf om jag ska vara ärlig.
Hade velat ta badhuset men eftersom jag tagit hål i naveln så vill jag inte bada i något äckligt badhus på minst ett år :P

Så istället åker jag till annika och hjälper henne att flytta :D


Pusss♥

 

lucia

Nu är jag hemma,
just nu sitter jag och övar på versen som jag ska säga på lucia,
kan den nästan ^^

"Jag är lucia, ljusets drottning
som uppsökt er denna kväll.
Där jag går fram ger mörkret vika,
från högsta slott till minsta tjäll.
Till människorna har jag kommit
i vintermörkrets tyngsta tid,
att skänka värme, ljus och glädje
och förbereda julens frid..."



Bryr du dig om du forlorar en femma?
Bryr du dig om du räddar ett liv?


 


bagaremaja

Vem är bäst på att baka?

jo


JAG :D


dom blev jättegoda!



Ibland måste man få skryta lite,
det är ju faktiskt MIN blogg :D hahahah


puuuuuuuuss

blatteblatte

Så bra det går att baka något så svenskt som lussekatter i en lägenhet full av blattar,
Dom hade inga vanliga russin så jag fick ta arabrussin.
russinen är gula?



1:a advent

´hejjaguppdateraronödigainlägg24/7

men ni får stå ut :D

Snart ska jag grädda lussekatterna,
Just dom här lussekatterna kommer bli något alldeles speciellt,
saffranet var tydligen skitdyrt eftersom det var importerat från libanon eller något skit,
hahahah perfekt om jag råkar bränna lussekatterna eller något :D


Eliya kom nyss hem och vi har suttit i hans och snackat om alla lärare.
Det är tydligen nån lärare på min skola som aldrig använder bh?
fresh



Puuuuuuusss ♥

julbak

Just nu håller jag på att baka lussekatter :D

Det går fan bättre än jag trodde!
hahah


Vi har besök från Libanon, vet inte om dom har smakat lussekatter nån gång :P

Aja, det återstår att se!

Puss♥

hej

Sitter hemma hos pappa och lär han om datorer :D
inte så lyckat kanske hahahha


Nu ska vi äte frukost,

Pusss♥


öga



Mina ögon är konstiga,
ibland är de bruna, ibland blå, och ibland gröna.


I held your hand


Kom nyss hem från stan,
först var mamma och tog sprutan,
sen blev det tuna park,
jag köpte en kjol till julafton,
en vanlig svart midjekjol (:
Bild kommer!
Köpte oxå ett par örhängen,
lila rosetter för bara 19 kr!

Sen så åkte vi och åt hos Elena&Judith och efter det så åkte vi till ÖB för att leta julstjärna,
men där hittade hon ingen,
mamma däremot,
köpte med sig en hel låda Magnum Ecuador! :D
Dom har ju slutat sålt den glassen i vanliga affärer till mammas förtret men tydligen hade ÖB köpt hem ett helt lager!

Efter det så åkte vi vidare till Rusta,
där vi äntligen hittade en julstjärna.

Sen pallade vi inte mer,
skjutsade hem Elena&Judith och åkte hem.

Nu sitter jag här och tråkar ^^

Senare ikväll åker jag till Julia,
vi MJMJ ska titta film och käka pizza.
Eller ja, ingen pizza för min del tror jag inte,
är inte alls sugen på det.

Puss♥


kärlek


svensson svensson in mah <3

Det är bra att alla MJMJ är friska nu!
Så att jag slipper detta "svensson svensson" mönster,
denna veckan har "svensson svensson" vart min eviga drog,
men nu har jag inte kollat på det på minst två dagar!
Det är ju på bättringsvägen iallafall, haha!

Snart ska jag ut, men inte än, Jennie, Malin och Julia är ju såå sega :D

Tror inte att jag bloggar när jag kommer hem, men det får vi se ^^

Puuuuuuss♥

porrfarbror

haha jag äter pizza för första gången på jättelänge, om man inte räknar med att jag snodde några bitar av Tobbe x'D

Kom precis hem från skolan och är hungrig som vanligt,
eftersom skolans mat ju är såååååå goooood !
eller inte.

Men ja, vid typ 6 så ska jag träffa tjejerna och jag vet inte riktigt vad som händer ^^
vi får se!



Förresten!
idag har jag lärt mig lite spanska :D

Una servecias, por favor!

Det betyder, "en öl tack!"

hahahah



Puss♥

torsdagsmyyyyyys

Den här människan som drev bloggen sarasklader.blogg.se har tydligen skaffat en ny blogg och fortsatt lura folk,
men snart stoppar jag henne, jag väntar bara på ett mejl.




Idag efter skolan så följde jag med Malnes hem,
(det blev ingen kör)
och efter ett tag så kom oxå Jens,
vi gjorde typ inget, åkte till kiosken och sen kollade på Hey Baberiba (:

Sen vid sju (?) kom mamma och så åkte vi och hälsade på hos Ola och barnen, Fia jobbade.
Vi kom nyss hem och Elena&Judith hängde på, dom ska sova här inatt.


Nu ska det pluggas engelskaverb...


Puss♥

svengelska

Sitter på bsvenskaengelskan just nu,
har precis haft en 70min lektion i kemi....
inte kul :P

Nu ska jag plugga engelska verb eftersom vi har prov på det imorgon...

Efter skolan tror jag att jag åker hem direkt men jag vet inte än om jag åker till Emil och tränar luciasånger,
sen vid sex så åker jag till kören (:

Puss♥

allt är mer eller mindre trasigt

Jag vet inte riktigt vad jag ska skriva,
är jättetrött så jag går väl och lägger mig snart,
eller iallafall kollar på tv ^^

Imorgon måste jag till skolan för det är kör på kvällen,
så den vill jag inte missa! (:

Och så har vi idrott imorgon...
villlinteeee!

Nej nu ska jag inte skriva en massa skit,


Puss♥

uh

Idag är jag hemma,
har ont i hela kroppen av den där fkn sprutan...

Vi har egentligen buffertdag (en sån dag där man tar igen allt man ligger efter i)
så jag får plugga som fan idag....



Puss♥

hör fåglarna sjunga

Godmorgon!
Jag sitter här och kollar på svensson svensson,
an usual?
vid nio kommer Julia och hennes mormor som är så snäll och skjutsar!

Ikväll vet jag inte riktigt än vad som händer,
om jag inte bestämmer något speciellt så åker jag och tränar luciasånger med Emil.

Puss♥

Luciaträning

Jag kom precis hem från luciaträningen,
och gissa vem som blev lucia!

Jo jag! ;D

Alla dom små barnen röstade fram lucian (:

Själva träningen gick bra, det var bara vissa låtar jag inte kunde, men det ska nog gå bra!

Sen ska jag läsa en vers oxå.


Imorgon blir det vaccination ^^


Puuuusss♥

kovältare

Just nu sitter jag och äter revbensbjäll ^^
Kom precis hem och vid fem åker jag med Emil (kusinbarn) till luciaträningen (:

Undrar vem som blir lucia iår!

Jag ska lägga in bakgrund och header till julias blogg nu!

Puss ♥

JAG VÅGAAADEEEEEEEE!

Jag. Maja Wally, stod framför en massa folk (okej, massa kanske var att ta i men endå) och sjöng SOLO !

För första gången i mitt liv!

Innan så trodde att jag skulle svimma, ni skulle ha sett mig o.O


Men sen när jag vä sjöng så gick det bra!


Nu kommer jg vara glad hela dagen, för tänk att jag vågade!


gör allt du inte vågar



PUSS <3

eeeeeloooooooooooooooooooise

Fy fan vad jag är trött!
Det blev sent igår kväll,
men fan vad kul vi hade!
Ulles kille Tobbe, hennes syster Ankan och hennes kille Tomas hade vart på dansbandskampen 
och sen när som kom hem så ville dom ju fortsätta dansa x'D
Så jag har för första gången i mitt liv dansat bugg och foxtrot!
Det gick faktiskt bra med buggen,
så i januari när Tobbe ska ha danskurs så ska jag nog börja :D
för det är ju kul (:

Vid tio är det kyrkan som gäller,
jag ska ju inte be eller någoet om ni tror det,
nej jag ska ju sjunga ^^

nervös? något!

Troligen sjunger jag solo i kyrkan imorgon, men jag vet inte om jag vågar!

Iochmed att det bara blir andra gången jag sjunger inför folk så kanske jag inte är redo för det...

Jag är så himla spänd redan, uhu ._.


Puss♥

Godmorgon

Det ver ju ingen vidare uppdatering igår, jag var ju bara sur,
Ingenting speciellt gjorde jag på hela dagen det enda jag gjorde var att kolla på Svensson Svensson hela kvällen.
Kul liv va?!

Igår kväll började jag oxå lite smått på boken Asyl,
och så läste jag ut den imorse på två timmar, så sysselsatt är jag !

Men boken är väldigt bra, så jag ska väl nångång snart fortsätta på uppföljaren,
vad den nu heter :P


Ikväll ska jag till Ulle, mer vet jag inte,
kanske åker mamma och jag till moster :P

Puss♥

:(

hej nolifer som sitter hemma och tittar på "svensson svensson" en fredagskväll.

Nu ska jag fortsätta ruttna bort.

puss </3


kfgjeiufgdischdeirkfhcviufrhtvhirgi

allt.går.ju.så.jävla.BRA


jag har sett fram emot att åka till Ebba och ha kul med alla tjejerna hela veckan, och var händer,
jo jag får ju feber, förståss !

Men febern har ju fan gått ner men inte FAN får jag åka .


Trevlig fredagskväll för min del. jovisst



Godmorgon

Det här börjar bli en sjukblogg,
nu är jag sjuk igen, feber,
men jag MÅSTE vara frisk tills klockan två!
För då ska jag till Ebba (:

Puss♥

*

Ny header, tills jag kommit på något bättre :*


Godnatt <3

header

Jag håller på med en ny desig till Jennie, som hon ska ha medans hon väntar på en fin,
hatar och fixa sånt nu för inget går som jag vill!
menmen :P

Jag håller på med en ny åt mig själv med en enkel bara.


Puss♥

twilight

überdissad känner jag mig!
Jag kliver av bussen från stan, och på vägen till mig finns det inte en enda lyktstolpe, ¨det kändes helt seriöst som om nån hade satt på mig en bindel för ögonen!
Så jag tänkte ringa nån, så ringer jag flera stycken men ingen svarar och sen när jag ringer Malin så får man höra att
"jag orkar inte prata i telefon"
snacka dissad ! -.-"

Så där fick jag gå helt själv i mörkret ._.

Vi var i stan, MJMJ, där gjorde vi typ inget speciellt ^^
Träffade Joel, Ida, Ebba och Sandra en stund bara.

 Sen imorgon sover vi hos Ebba,
Så det blir ingen bloggning alls :(



Puss♥

pluuuuuuugggggggggaaaaaaa

Idag var det elevens val,
jätteonödig dag eftersom jag har "pärlor, pyssel och prat" så då sitter man bara och pärlar hela dagen...

Efter skolan så åkte jag till min brors kiosk en stund,
bara nån kvart blev det,
för sen så var det dags för utvecklingssamtal...
Gick väl helt okej ^^

Sen åkte vi direkt hem och det enda jag har gjort nu under kvällen är att plugga, plugga, plugga !

NO prov imorgon, och det är en massa att plugga på!
Troligen har vi prov men vår NO lärare är sjuk så jag vet inte om hon kommer :P

aja,
Efter skolan imorgon åker vi MJMJ ner på staaaan :DDDD
Hundra år sen som vi träffades alla fyra,
nu har ju äntligen Jennie och Malin blivit friska ♥


Puuuuusss♥

Vinn en Iphone!




Nu är det såhär va att jag tävlar om en Iphone på
Fokis.se !

Man fick välja ut ett fint skal till och sen skulle man länka!

Så jag gör det igen :

www.fokis.se


Skalet som jag valde ser utsåhär:


och länken till skalet finns    
HÄR 


Hoppas jag vinner (:

Puss ♥

libanon i sommar?

Hej !

Just nu sitter jag och pratar med min brors fru i libanon,
min pappa kommer ju därifrån och har tagit med sig sin fru och 5 av mina bröder därifrån för flera år sen men en av dom bor fortfarande kvar i libanon :)

Så just nu sitter jag altså och snackar med hans fru, på engelska !
Inte klokt va :D

Idag hade jag ju kören,
det gick väl sådär,
det var bara jag där idag :(
och sen är jag fortfarande kärv i halsen så jag kunde inte "sjunga ut" ordentligt.


Imorgon är det elevens val och utvecklingssamtal....


Puss♥

sovmorgon

Idag ska jag till skolan,
men vi har sovmorgon (:

Julia och hennes mamma kommer till nio,
men jag ville ha en morgon utan stress så jag gick endå upp vid kvart i sju (a'

Efter skolan är det kör,
kanske inte så bra för min hals men jag måste iallafall försöka
med tanke på att det är sista övningen innan vi ska sjunga i kyrkan :D


Puss♥


bara fina vänner består

Nu har jag kollat på Twilight och Tingeling 2 :D
kärlek på dom va'

Nu återstår NOpluggande och NOpluggande ....

Puss♥

sjuk

Godmorgon!

Jag är inte i skolan idag,
har ont i halsen,
som typ varannan vecka då :(

Det är demokratidag i skolan idag medså jag missar ju inget som tur är.

Att sjunga med kyrkokören igår gick bra,
förrutom att jag sjöng Allt stämma men jag skulle ha sjungt Sopran stämma ._.

Menmen.


Nu kollar jag på bert :D
Senare ska jag jobba NO och SO


Puss♥

Judith

Barnvakteriet var gått jättebra!
Hon bara ler hela tiden ♥

Just nu ligger hon och sover i mammas knä,
Nybadad och nyäten :D

Iris är oxå här ♥


Puuusss♥

last words

Hej!

Sitter här med en leende Judith i en babysitter bredvid mig (:
Sötare leende finns inte!
Ellr rättare sagt, sötare unge finns inte !

Vi ska vara barnvakt inatt, jag och Mamma.

Idag har det inte hänt så mycket, vi var hemma hos Moster&Göran på dan.
Kusinen med barn var oxå där (:

Imorgon kväll ska vi sjunga i kyrkan, Jag och Denise.


Puss ♥

fredagen den trettonde

inget olyckligt har hänt mig idag, so far! det är ju fortfarande tio minuter kvar av dagen :D
hahah jag väntar och ser (a'

Idag hade vi demokratidag i skolan, idag handlade det om kvinnliga och manliga roller i samhället.
Först körde vi "heta stolen", man satt i en ring allihopa och höll man med på påståendet som läraren sa då skulle man byta plats, jag kände mig väldigt demokratisk faktiskt :D
Vi skulle även skriva en insändare till tidningen, jag skrev om skolmaten.

Efter skolan så åkte jag hem till Sophie (:

Är jag inte snygg va?! :DDD


Vid sex åkte vi hem till Denise, där åt vi tacos och sjöng mest karaoke (:
Men vi hann oxå kolla på "Aquamarine" den vad bra.

Imorgon kväll är jag och Mamma barnvakt åt Judith, annars har jag inte bestämt mig om vad som händer under dagen.
Vi får se (:


Puss♥

say what you wanna say

Det är redan mörkt ute, och klockan är bara fem.
Nu är ju vintern här så det kanske inte är så konstigt, det konstiga är att det är inte förrns nu som jag märker det ^^

Jag hälsade aldrig på Maliin :( hon mådde för dåligt..
Krya gumman♥

Imorgon är det demokratidag i skolan, inte för att jag vet vad det är men detär nog bättre än en vanlig skoldag!
Lite synd att vi missar slöjden...
Jag håller på och stickar en mössa, en vit.
Är nog snart klar, perfekt nu till vintern! :D


MJMJ ♥ seriösa 24/7


/


when his calling for you

Nu har jag precis kommit hem, är proppmätt!
Den enda gången jag kommer hem och är mätt, det är varannan onsdag, då vi har hemkunskap....
Idag gjorde vi foccatiabröd och potatisochpurjolökssoppa (:

Nu, resten av kvällen består av pluggande bara :(
Hade velat åka till Malin idag men jag gör det imorgon, om hon svarar nångång...

Puuss <3


så fint


borstar tänderna som en galning

Nu har jag vart hemma att tag,
trodde inte jag skulle hinna blogga idag men så kom jag på att provet var framflyttat tills på torsdag istället,
så då har jag både idag och imorgon på mig att plugga (:
Tur! för jag kan typ ingenting av detdär !

Efter skolan så åkte jag och Denise direkt till kören, Thessan hade ont i halsen så hon kunde inte komma :(
Vi bestämde oss för att sjunga "så vill stjärnorna" den 22 november, då vi ska sjunga i kyrkan.
Det blir nog bra.


Imorgon ska Jennie och Julia hem till Malin, som ligger hemma och har vattenkoppor :(
Jag vill jättegärna oxå följa med dit men jag känner att jag verkligen måste plugga till provets å jag åker nog dit på torsdag istället (:

Vet inte om jag först åker till skolan imorgon eller om jag skaffar mig en sovmorgon med tanke på att jag ska till tandläkaren halv tio....
ångest.

haha

Puss♥

Godmorgon!

Jag har sovmorgon idag, men vaknade ändå vid halvsju för att inte behöva stressa alls (:
skönt

Idag slutar jag vid fyra och sen blir det att åka vidare till kören direkt,
vi ska sjunga idag istället för på torsdag,
Förresten ska vi tydligen sjunga i kyrkan den 22 (:

Igår berättade jag för Mamma om vad jag gjorde hos Ulle,
tog hål i naveln.
Eftersom jag hade en ögonbrynspiercing i så åkte jag till Laboro igår och köpte en annan,
han som jobbade där hjälpte mig med att byta också (:
Nu tvättar jag det typ 24/7 för det ser ut att bli infekterat, vilket det absolut inte får bli!

Jag har världens bästa Mamma så att alla vet!
Det kan ni skriva upp någonstans ♥

Puss♥

(:

Idag var det skola då, inget speciellt alls :P
Efter skolan så åkte jag och Julia in till stan en stund och kollade skor.
Efter det så drog jag till Annika en stund men nästan direkt så åkte vi in till stan igen och gick runt (:

Nu är det att plugga till hälsaprov som gäller....
uhu ._.


Puss♥ 

röd

Igår när Malin äntligen hade vaknat och vi satt vid datan i pyjamas så kom Skancke och Wille,
dom berättade att natten innan så hade dom kommit hem till mig och knackat på fönstrena eftersom dom trodde att vi var vakna, men eftersom vi inte hade reagerat (vi sov ju !) så hade dom tagit stegen och ställt vid mitt fönster!
Sen hade Skancke tydligen klättrat upp och knackat på fönsterkarmen!
Fy fan! jag hade dött om jag hade vaknat!
Jag som inte ens vågar titta ut där vanligtvis när det är mörkt och så sen om man tittar ut och ser ett ansikte utanför! uhu!
Helt störda är dom, hahahah

Efter Malin hade åkt hem så var jag med dom ett tag till och sen åkte jag hem till Ulle och sov där.
Vi gjorde typ inget speciellt, följde med hennes syster och kusin till Vingåker vid sex för att hämta grejer, sjukt långt att åka!
Vi blev typ stammisar på statoil! tre gånger var vi därinne! hahah

Sen så åkte vi hem till Ulle igen och kollade på porrfilm i brist på annat HAHAHA
"spansk erotik" så otroooooooooligt bra! :DDDDDDD
hahah


Nu är jag hemma hos min pappa, vi har precis ätit.
Innan dess så var vi inne i stan, min brors fru och deras två barn, och handlade farsdagpresent och present till min bror som fyllde i veckan (:


Imorgon vet jag inte vad som händer, ska troligen hem till Annika (:

Pussssss <3


engelska i regnet

Igår åkte vi ju till balsta,
inte speciellt kul, bara liiiiiite :D
Men jag fick ju träffa Sara, Kaj, Perss och Lollo ♥

Malin och jag drog hem tidigt eftersom det inte hände något (a'
Men sen gick vi ut typ direkt och träffa Skancke och Wille, plus lite mer folk.
Lite senare kom Jennie och Julia oxåååååå ♥

Vi pratade engelska hela vägen hem och när vi var hemma oxå,
haha :D
vi borde få MVG i engelska nu när vi tillochmed pratar det på fritiden ! (:

Det regnade jättemycket hela vägen hem,
vi var asblöta när vi kom fram xD


Just nu ligger Malin och sover, jag vaknade av en ringande konfirmationsledare -.-"

Idag ska jag handla farsdagpresent och så vet jag inte om jag träffar Ulle ikväll (:

Puss♥

:DDDDDDDDDDD

Nu vid sex drar vi, MJMJ till Balsta :D
Ska lyssna på några band och sen sover Malin här !

Skolan var väl lite, ja, sådär.
Men vi fick tårtaa !! :DDD
"bäst utklädda klass" på halloween ^^


puuuuuuuuss♥ 

MJMJ

Med er klarar jag

Allt


Godnatt!

Det blir ett snabbt godnattinlägg nu! (så snabbt som det går med en dator seg som synden....)
Imorgon slutar jag fyra och åker direkt hem eftersom jag måste träna på musikprovet, som jag förövrigt inte ens har tittat på...

Just ja! sovmorgon imorgon (:


Puss♥


nothing happens when you dont try

Hej!
Idag slutade vi tidigt, för vi var på ungdomsmottagningen.
Haha där kollade vi på en film som hette "kondomfilmen", otroooooooooooligt bra :D

Altså hade vi bara en lektion idag, SO, vi fick tillbaka proven och jag hade knappt G...
Fast det var ett väldigt svårt prov tycker jag så det är lungt.

Efter skolan gick vi, MJMJ, på stan.
Jag köpte inget, eller jo, vi åt på Subway!
Jättegott (:


Puss♥


want to make a change

Nu är jag hemma från pappa, proppmätt oxå, åt som fan för dom gör alltid så himla mycket olika sorters mat så man måste ju prova på allt ;D

Jag och Ali (1år) satt och poppade till caramelldansen, smurflåtar och introt till Hamtaro!
kuul !

Imorgon är det skola igen, orkar verkligen inte *ångest*
Fattar inte hur jag kommer orka upp med tanke på mitt näst intill omvända dygn...

Men nu är det "bara" 6½ vecka kvar till nästa lov :D


Puuuuuuss <3 

Godmorgon (:

Nu är jag hemma hos pappa, kom precis.
Vi ska väl äta frukost typ nu tror jag.
Eller ja, det är om jag offrar mig att gå till kiosken och hämta ägg...

Haha jag och min bror skickar sms med varann fastän vi bara är i olika rum,
haha.

Usch jag är jätte trött!
Somnade typ vid fyra nånting och vaknade vid halvelva eftersom jag skulle hit...
Vi sov fyra stycken i Jennies säng, fast ijuförsig så har hon ju en dubbelsäng men det var trångt endå,
för mig som låg ytterst, och så vaknade jag typ vid 6 av Julias fötter xD
Helt plötsligt låt hon med fötterna på huvudkudden!
Fast det är ju inte så konstigt, hon barukade ju kallas pippilångstrump förut, fast det var ju ett tag sen,
hahah!

Puss♥
 


The hills have eyes

Jag sitter just nu hemma hos jennie och kollar på en sjukt äcklig film på tv400.
Skancke, Julia och Malin är oxå här, Malnes var här förut men drog vid elva.
Jag sover kvar här inatt och åker till pappa vid halv elva imorgon.

Jag skriver nog mer imorgon.

Puss♥

RSS 2.0